Review



bp0089 invivoplus anti mouse pd 1  (Bio X Cell)


Bioz Verified Symbol Bio X Cell is a verified supplier
Bioz Manufacturer Symbol Bio X Cell manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    Bio X Cell bp0089 invivoplus anti mouse pd 1
    Bp0089 Invivoplus Anti Mouse Pd 1, supplied by Bio X Cell, used in various techniques. Bioz Stars score: 96/100, based on 302 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bp0089+invivoplus+anti+mouse+pd+1/InVivoPlus+rat+IgG2a+isotype+control%2C+anti-trinitrophenol/pm41046514-647-87-94
    Average 96 stars, based on 302 article reviews
    bp0089 invivoplus anti mouse pd 1 - by Bioz Stars, 2026-11
    96/100 stars

    Images

    Related Articles

    Western Blot:

    Article Title: Spliceosome inhibition induces Z-RNA and ZBP1-driven cell death in small cell lung cancer.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, peptides, and recombinant proteins Pladienolide B Cayman Chemicals Cat# 445493-23-2; ID 16538 Matrigel Matrix Corning Cat# 354234 Bovine Serum Albumin (BSA) Fisher Scientific Cat# BP9703-100 RNaseA Thermo Fisher Scientific Cat# EN0531 RNaseH Thermo Fisher Scientific Cat# 18021014 DNaseI Set Zymo Research Cat# E1011-A Glycogen Thermo Fisher Scientific Cat# R0551 ITS Supplement Sigma Cat# 11884 B-Estradiol Sigma Cat# E2257 Hydrocortisone Sigma Cat# H4001 FBS Hyclone Cat# AAF204954 RPMI 1640 Medium Corning Cat# MT-50-020-PB Sodium Pyruvate Sigma Cat# P2256 HEPES Fisher Scientific Cat# BP310-500 Dextrose (D-) Glucose Fisher Scientific Cat# D15-500 Dulbecco’s Modification of Eagle’s Medium (DMEM) Corning Cat# MT50-013-PB Phosphate Buffered Saline 10X Corning Cat# 46-013-CM Penicillin Streptomycin Corning Cat# 30-002-CI L-Glutamine Corning Cat# 25-005-CI Paraformaldehyde, 4% in PBS Thermo Fisher Scientific Cat# J61899 Phosphate Buffered Saline Sigma Cat# D5652 Triton X-100 Sigma Cat# X100-500ML MAXblock Blocking Medium Active Motif Cat# 102224 ProLong Gold Antifade Mountant with DNA Stain DAPI Thermo Fisher Scientific Cat# P36935 Sucrose Thermo Fisher Scientific Cat# 036508.A1 Pierce RIPA Buffer Thermo Fisher Scientific Cat# 89900 Halt Protease Inhibitor Cocktail (100X) Thermo Fisher Scientific Cat# 78430 Halt Phosphatase Inhibitor Cocktail (100X) Thermo Fisher Scientific Cat# 78428 Chameleon Duo Pre-Stained Protein Ladder LICORbio Cat# 928-60000 Puromycin GIBCO Cat# A11138-03 Can Get Signal Immunoreaction Enhancer Solution 1 TOYOBO Cat# NKB-101 Can Get Signal Immunoreaction Enhancer Solution 2 TOYOBO Cat# NKB-201 Intercept Antibody Diluent LI-COR Cat# 927-65001 CoverGrip Coverslip Sealant Biotium Cat# 23005 Tween 20 Thermo Fisher Scientific Cat# J20605-AP IGEPAL Sigma Cat# 9002-93-1 1M MgCl 2 Invitrogen Cat# AM9530G 0.5M EDTA Solution (100X) Thermo Fisher Scientific Cat# 1860851 5M NaCl Thermo Fisher Scientific Cat# AM9759 Ambion DEPC-Treated Water Thermo Fisher Scientific Cat# AM9922 SuperScript III Reverse Transcriptase Thermo Fisher Scientifics Cat# 18080-044 RNaseOUT Ribonuclease Inhibitor Thermo Fisher Scientific Cat# 10777019 Power SYBR Green PCR Master Mix Applied Biosystems Cat# 4367659 (Continued on next page) Cell Reports 44, 116384, October 28, 2025 15 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligo (dT) 12–18 Primer Life Technologies Cat# 18418012 Random Primers Thermo Fisher Scientific Cat# 48190011 dNTP Mix, 10mM each Thermo Fisher Scientific Cat# R0191 TRIzol Reagent Thermo Fisher Scientific Cat# 15596018 2-Mercaptoethanol Bio-Rad Cat# 1610710 cOmplete Mini, EDTA-free Roche Cat# 11836170001 Collagenase P Roche Cat# 11213865001 Restore PLUS Western Blot Stripping Buffer Thermo Fisher Scientific Cat# 46430 InVivoPure pH 7.0 Dilution Buffer BioXCell Cat# IP0070 InVivoPlure pH 6.5 Dilution Buffer BioXCell Cat# IP0065 InVivoPlus rat IgG2a isotype control, Clone 2A3 BioXCell Cat# BP0089 InVivoPlus anti-mouse PD-1 (CD279), clone RMP1-14 BioXCell Cat# BP0146 SuperScript IV VILO Master Mix Thermo Fisher Scientific Cat# 11756050 RNasin Plus RNase Inhibitor Promega Cat# N2615 RNase ONE Ribonuclease Promega Cat #M4261 GSK843 Sigma Cat# SML2001-5MG Z-VAD-FMK Sellectchem Cat# S7023 Necrostatin-1 APExBio Cat# A4213 Cycloheximide Sigma Cat# C4859-1ML Recombinant Mouse TNF alpha (aa 80–235) Protein R&D Systems Cat# 410-MT Collagenase Sigma Cat# C5138-1G DnaseI from bovine pancreas grade II Roche Cat# 10104159001 MicroAmp Fast Optical 96-Well Reaction Plate with Barcode Applied Biosystems Cat# 4346906 Propidium Iodide Sigma Cat# P4170 10X TBS Bio-Rad Cat# 1706435 Mini Trans-Blot Filter Paper Bio-Rad Cat# 1703932 Phosphate Buffered Saline 10X Molecular Biology Grade Corning Cat# 46-013-CM RBC Lysis Buffer (10X) BioLegend Cat# 420302 Chloroform Fisher Scientific Cat# BP1145-1 Phenol:Chloroform:Isoamyl Alcohol 125:24:1 Sigma Cat# P1944-100ML Nitrocellulose Membrane, 0.45μM Bio-Rad Cat# 1620115 Nunc Lab-Tek II Chamber Slide System, 8 Wells Thermo Fisher Scientific Cat# 154941 Cover Slips Super Slip Epredia Cat# 12450S Polybrene (CAS 28728-55-4) Santa Cruz Cat# sc-134220A Sodium Bicarbonate Fisher Scientifics Cat# BP328-500 Actinomycin D Sigma Cat# A9415 Critical commercial assays Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat# 23225 CellTiter-Glo Luminescent Cell Viability Promega Cat# G7571 Bio-Rad Wet Tank Blotting System Bio-Rad Cat# 1658034 RNA Clean & Concentrator – 25 Zymo Research Cat# R1017 (Continued on next page) 16 Cell Reports 44, 116384, October 28, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Silencer Select Negative Control #1 siRNA Thermo Fisher Scientific Cat# 4390844 SF3B1 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4392420; ID: s223598 LRDD Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4392420; ID: s30843 PTEN Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4427037; ID: s61224 Pbrm1 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4390771; ID: s232536 RBM5 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4427037; ID: s19842 Herc4 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4390771; ID: s84900 Ddx31 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4390771; ID: s105733 Hdac6 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4390771; ID: s67426 Hhx32 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4390771; ID: s97751 STK38 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4427037; ID: s22337 sgSF3B1 forward3: CACCGGAGAACTAAAAGTCG TCAA This Paper N/A sgSF3B1 reverse3: AAACTTGACGACTTTTAGTT CTCC This Paper N/A sgSF3B1 forward4: CACCGATAGCGGTTCAATGAC CACG This Paper N/A sgSF3B1 reverse4: AAACCGTGGTCATTGAACCGC TATC This Paper N/A sgSf3b1 forward3: CACCGAGACTGAAATTCTCG AATG This Paper N/A sgSf3b1 reverse3: AAACCATTCGAGAATTTCAG TCTC This Paper N/A sgSf3b1 forward4: CACCGATTACTATGCTAGAG TGGA This Paper N/A sgSf3b1 reverse4: AAACTCCACTCTAGCATAGT AATC This Paper N/A sgSf3b2 forward1: CACCGAAGTACCTTCAAGGC AAACG This Paper N/A sgSf3b2 reverse1: AAACCGTTTGCCTTGAAGGTA CTTC This Paper N/A sgSf3b2 forward2: CACCGTCGTCCTATAGGGAG TCGCG This Paper N/A sgSf3b2 reverse2: AAACCGCGACTCCCTATAGG ACGAC This Paper N/A sgSf3b3 forward1: CACCGAACACTCTGGTGTA TCACG This Paper N/A sgSf3b3 reverse1: AAACCGTGATACACCAGAG TGTTC This Paper N/A (Continued on next page) 18 Cell Reports 44, 116384, October 28, 2025

    Stripping:

    Article Title: Spliceosome inhibition induces Z-RNA and ZBP1-driven cell death in small cell lung cancer.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, peptides, and recombinant proteins Pladienolide B Cayman Chemicals Cat# 445493-23-2; ID 16538 Matrigel Matrix Corning Cat# 354234 Bovine Serum Albumin (BSA) Fisher Scientific Cat# BP9703-100 RNaseA Thermo Fisher Scientific Cat# EN0531 RNaseH Thermo Fisher Scientific Cat# 18021014 DNaseI Set Zymo Research Cat# E1011-A Glycogen Thermo Fisher Scientific Cat# R0551 ITS Supplement Sigma Cat# 11884 B-Estradiol Sigma Cat# E2257 Hydrocortisone Sigma Cat# H4001 FBS Hyclone Cat# AAF204954 RPMI 1640 Medium Corning Cat# MT-50-020-PB Sodium Pyruvate Sigma Cat# P2256 HEPES Fisher Scientific Cat# BP310-500 Dextrose (D-) Glucose Fisher Scientific Cat# D15-500 Dulbecco’s Modification of Eagle’s Medium (DMEM) Corning Cat# MT50-013-PB Phosphate Buffered Saline 10X Corning Cat# 46-013-CM Penicillin Streptomycin Corning Cat# 30-002-CI L-Glutamine Corning Cat# 25-005-CI Paraformaldehyde, 4% in PBS Thermo Fisher Scientific Cat# J61899 Phosphate Buffered Saline Sigma Cat# D5652 Triton X-100 Sigma Cat# X100-500ML MAXblock Blocking Medium Active Motif Cat# 102224 ProLong Gold Antifade Mountant with DNA Stain DAPI Thermo Fisher Scientific Cat# P36935 Sucrose Thermo Fisher Scientific Cat# 036508.A1 Pierce RIPA Buffer Thermo Fisher Scientific Cat# 89900 Halt Protease Inhibitor Cocktail (100X) Thermo Fisher Scientific Cat# 78430 Halt Phosphatase Inhibitor Cocktail (100X) Thermo Fisher Scientific Cat# 78428 Chameleon Duo Pre-Stained Protein Ladder LICORbio Cat# 928-60000 Puromycin GIBCO Cat# A11138-03 Can Get Signal Immunoreaction Enhancer Solution 1 TOYOBO Cat# NKB-101 Can Get Signal Immunoreaction Enhancer Solution 2 TOYOBO Cat# NKB-201 Intercept Antibody Diluent LI-COR Cat# 927-65001 CoverGrip Coverslip Sealant Biotium Cat# 23005 Tween 20 Thermo Fisher Scientific Cat# J20605-AP IGEPAL Sigma Cat# 9002-93-1 1M MgCl 2 Invitrogen Cat# AM9530G 0.5M EDTA Solution (100X) Thermo Fisher Scientific Cat# 1860851 5M NaCl Thermo Fisher Scientific Cat# AM9759 Ambion DEPC-Treated Water Thermo Fisher Scientific Cat# AM9922 SuperScript III Reverse Transcriptase Thermo Fisher Scientifics Cat# 18080-044 RNaseOUT Ribonuclease Inhibitor Thermo Fisher Scientific Cat# 10777019 Power SYBR Green PCR Master Mix Applied Biosystems Cat# 4367659 (Continued on next page) Cell Reports 44, 116384, October 28, 2025 15 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligo (dT) 12–18 Primer Life Technologies Cat# 18418012 Random Primers Thermo Fisher Scientific Cat# 48190011 dNTP Mix, 10mM each Thermo Fisher Scientific Cat# R0191 TRIzol Reagent Thermo Fisher Scientific Cat# 15596018 2-Mercaptoethanol Bio-Rad Cat# 1610710 cOmplete Mini, EDTA-free Roche Cat# 11836170001 Collagenase P Roche Cat# 11213865001 Restore PLUS Western Blot Stripping Buffer Thermo Fisher Scientific Cat# 46430 InVivoPure pH 7.0 Dilution Buffer BioXCell Cat# IP0070 InVivoPlure pH 6.5 Dilution Buffer BioXCell Cat# IP0065 InVivoPlus rat IgG2a isotype control, Clone 2A3 BioXCell Cat# BP0089 InVivoPlus anti-mouse PD-1 (CD279), clone RMP1-14 BioXCell Cat# BP0146 SuperScript IV VILO Master Mix Thermo Fisher Scientific Cat# 11756050 RNasin Plus RNase Inhibitor Promega Cat# N2615 RNase ONE Ribonuclease Promega Cat #M4261 GSK843 Sigma Cat# SML2001-5MG Z-VAD-FMK Sellectchem Cat# S7023 Necrostatin-1 APExBio Cat# A4213 Cycloheximide Sigma Cat# C4859-1ML Recombinant Mouse TNF alpha (aa 80–235) Protein R&D Systems Cat# 410-MT Collagenase Sigma Cat# C5138-1G DnaseI from bovine pancreas grade II Roche Cat# 10104159001 MicroAmp Fast Optical 96-Well Reaction Plate with Barcode Applied Biosystems Cat# 4346906 Propidium Iodide Sigma Cat# P4170 10X TBS Bio-Rad Cat# 1706435 Mini Trans-Blot Filter Paper Bio-Rad Cat# 1703932 Phosphate Buffered Saline 10X Molecular Biology Grade Corning Cat# 46-013-CM RBC Lysis Buffer (10X) BioLegend Cat# 420302 Chloroform Fisher Scientific Cat# BP1145-1 Phenol:Chloroform:Isoamyl Alcohol 125:24:1 Sigma Cat# P1944-100ML Nitrocellulose Membrane, 0.45μM Bio-Rad Cat# 1620115 Nunc Lab-Tek II Chamber Slide System, 8 Wells Thermo Fisher Scientific Cat# 154941 Cover Slips Super Slip Epredia Cat# 12450S Polybrene (CAS 28728-55-4) Santa Cruz Cat# sc-134220A Sodium Bicarbonate Fisher Scientifics Cat# BP328-500 Actinomycin D Sigma Cat# A9415 Critical commercial assays Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat# 23225 CellTiter-Glo Luminescent Cell Viability Promega Cat# G7571 Bio-Rad Wet Tank Blotting System Bio-Rad Cat# 1658034 RNA Clean & Concentrator – 25 Zymo Research Cat# R1017 (Continued on next page) 16 Cell Reports 44, 116384, October 28, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Silencer Select Negative Control #1 siRNA Thermo Fisher Scientific Cat# 4390844 SF3B1 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4392420; ID: s223598 LRDD Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4392420; ID: s30843 PTEN Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4427037; ID: s61224 Pbrm1 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4390771; ID: s232536 RBM5 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4427037; ID: s19842 Herc4 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4390771; ID: s84900 Ddx31 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4390771; ID: s105733 Hdac6 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4390771; ID: s67426 Hhx32 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4390771; ID: s97751 STK38 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4427037; ID: s22337 sgSF3B1 forward3: CACCGGAGAACTAAAAGTCG TCAA This Paper N/A sgSF3B1 reverse3: AAACTTGACGACTTTTAGTT CTCC This Paper N/A sgSF3B1 forward4: CACCGATAGCGGTTCAATGAC CACG This Paper N/A sgSF3B1 reverse4: AAACCGTGGTCATTGAACCGC TATC This Paper N/A sgSf3b1 forward3: CACCGAGACTGAAATTCTCG AATG This Paper N/A sgSf3b1 reverse3: AAACCATTCGAGAATTTCAG TCTC This Paper N/A sgSf3b1 forward4: CACCGATTACTATGCTAGAG TGGA This Paper N/A sgSf3b1 reverse4: AAACTCCACTCTAGCATAGT AATC This Paper N/A sgSf3b2 forward1: CACCGAAGTACCTTCAAGGC AAACG This Paper N/A sgSf3b2 reverse1: AAACCGTTTGCCTTGAAGGTA CTTC This Paper N/A sgSf3b2 forward2: CACCGTCGTCCTATAGGGAG TCGCG This Paper N/A sgSf3b2 reverse2: AAACCGCGACTCCCTATAGG ACGAC This Paper N/A sgSf3b3 forward1: CACCGAACACTCTGGTGTA TCACG This Paper N/A sgSf3b3 reverse1: AAACCGTGATACACCAGAG TGTTC This Paper N/A (Continued on next page) 18 Cell Reports 44, 116384, October 28, 2025

    Control:

    Article Title: Spliceosome inhibition induces Z-RNA and ZBP1-driven cell death in small cell lung cancer.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, peptides, and recombinant proteins Pladienolide B Cayman Chemicals Cat# 445493-23-2; ID 16538 Matrigel Matrix Corning Cat# 354234 Bovine Serum Albumin (BSA) Fisher Scientific Cat# BP9703-100 RNaseA Thermo Fisher Scientific Cat# EN0531 RNaseH Thermo Fisher Scientific Cat# 18021014 DNaseI Set Zymo Research Cat# E1011-A Glycogen Thermo Fisher Scientific Cat# R0551 ITS Supplement Sigma Cat# 11884 B-Estradiol Sigma Cat# E2257 Hydrocortisone Sigma Cat# H4001 FBS Hyclone Cat# AAF204954 RPMI 1640 Medium Corning Cat# MT-50-020-PB Sodium Pyruvate Sigma Cat# P2256 HEPES Fisher Scientific Cat# BP310-500 Dextrose (D-) Glucose Fisher Scientific Cat# D15-500 Dulbecco’s Modification of Eagle’s Medium (DMEM) Corning Cat# MT50-013-PB Phosphate Buffered Saline 10X Corning Cat# 46-013-CM Penicillin Streptomycin Corning Cat# 30-002-CI L-Glutamine Corning Cat# 25-005-CI Paraformaldehyde, 4% in PBS Thermo Fisher Scientific Cat# J61899 Phosphate Buffered Saline Sigma Cat# D5652 Triton X-100 Sigma Cat# X100-500ML MAXblock Blocking Medium Active Motif Cat# 102224 ProLong Gold Antifade Mountant with DNA Stain DAPI Thermo Fisher Scientific Cat# P36935 Sucrose Thermo Fisher Scientific Cat# 036508.A1 Pierce RIPA Buffer Thermo Fisher Scientific Cat# 89900 Halt Protease Inhibitor Cocktail (100X) Thermo Fisher Scientific Cat# 78430 Halt Phosphatase Inhibitor Cocktail (100X) Thermo Fisher Scientific Cat# 78428 Chameleon Duo Pre-Stained Protein Ladder LICORbio Cat# 928-60000 Puromycin GIBCO Cat# A11138-03 Can Get Signal Immunoreaction Enhancer Solution 1 TOYOBO Cat# NKB-101 Can Get Signal Immunoreaction Enhancer Solution 2 TOYOBO Cat# NKB-201 Intercept Antibody Diluent LI-COR Cat# 927-65001 CoverGrip Coverslip Sealant Biotium Cat# 23005 Tween 20 Thermo Fisher Scientific Cat# J20605-AP IGEPAL Sigma Cat# 9002-93-1 1M MgCl 2 Invitrogen Cat# AM9530G 0.5M EDTA Solution (100X) Thermo Fisher Scientific Cat# 1860851 5M NaCl Thermo Fisher Scientific Cat# AM9759 Ambion DEPC-Treated Water Thermo Fisher Scientific Cat# AM9922 SuperScript III Reverse Transcriptase Thermo Fisher Scientifics Cat# 18080-044 RNaseOUT Ribonuclease Inhibitor Thermo Fisher Scientific Cat# 10777019 Power SYBR Green PCR Master Mix Applied Biosystems Cat# 4367659 (Continued on next page) Cell Reports 44, 116384, October 28, 2025 15 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligo (dT) 12–18 Primer Life Technologies Cat# 18418012 Random Primers Thermo Fisher Scientific Cat# 48190011 dNTP Mix, 10mM each Thermo Fisher Scientific Cat# R0191 TRIzol Reagent Thermo Fisher Scientific Cat# 15596018 2-Mercaptoethanol Bio-Rad Cat# 1610710 cOmplete Mini, EDTA-free Roche Cat# 11836170001 Collagenase P Roche Cat# 11213865001 Restore PLUS Western Blot Stripping Buffer Thermo Fisher Scientific Cat# 46430 InVivoPure pH 7.0 Dilution Buffer BioXCell Cat# IP0070 InVivoPlure pH 6.5 Dilution Buffer BioXCell Cat# IP0065 InVivoPlus rat IgG2a isotype control, Clone 2A3 BioXCell Cat# BP0089 InVivoPlus anti-mouse PD-1 (CD279), clone RMP1-14 BioXCell Cat# BP0146 SuperScript IV VILO Master Mix Thermo Fisher Scientific Cat# 11756050 RNasin Plus RNase Inhibitor Promega Cat# N2615 RNase ONE Ribonuclease Promega Cat #M4261 GSK843 Sigma Cat# SML2001-5MG Z-VAD-FMK Sellectchem Cat# S7023 Necrostatin-1 APExBio Cat# A4213 Cycloheximide Sigma Cat# C4859-1ML Recombinant Mouse TNF alpha (aa 80–235) Protein R&D Systems Cat# 410-MT Collagenase Sigma Cat# C5138-1G DnaseI from bovine pancreas grade II Roche Cat# 10104159001 MicroAmp Fast Optical 96-Well Reaction Plate with Barcode Applied Biosystems Cat# 4346906 Propidium Iodide Sigma Cat# P4170 10X TBS Bio-Rad Cat# 1706435 Mini Trans-Blot Filter Paper Bio-Rad Cat# 1703932 Phosphate Buffered Saline 10X Molecular Biology Grade Corning Cat# 46-013-CM RBC Lysis Buffer (10X) BioLegend Cat# 420302 Chloroform Fisher Scientific Cat# BP1145-1 Phenol:Chloroform:Isoamyl Alcohol 125:24:1 Sigma Cat# P1944-100ML Nitrocellulose Membrane, 0.45μM Bio-Rad Cat# 1620115 Nunc Lab-Tek II Chamber Slide System, 8 Wells Thermo Fisher Scientific Cat# 154941 Cover Slips Super Slip Epredia Cat# 12450S Polybrene (CAS 28728-55-4) Santa Cruz Cat# sc-134220A Sodium Bicarbonate Fisher Scientifics Cat# BP328-500 Actinomycin D Sigma Cat# A9415 Critical commercial assays Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat# 23225 CellTiter-Glo Luminescent Cell Viability Promega Cat# G7571 Bio-Rad Wet Tank Blotting System Bio-Rad Cat# 1658034 RNA Clean & Concentrator – 25 Zymo Research Cat# R1017 (Continued on next page) 16 Cell Reports 44, 116384, October 28, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Silencer Select Negative Control #1 siRNA Thermo Fisher Scientific Cat# 4390844 SF3B1 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4392420; ID: s223598 LRDD Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4392420; ID: s30843 PTEN Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4427037; ID: s61224 Pbrm1 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4390771; ID: s232536 RBM5 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4427037; ID: s19842 Herc4 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4390771; ID: s84900 Ddx31 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4390771; ID: s105733 Hdac6 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4390771; ID: s67426 Hhx32 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4390771; ID: s97751 STK38 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4427037; ID: s22337 sgSF3B1 forward3: CACCGGAGAACTAAAAGTCG TCAA This Paper N/A sgSF3B1 reverse3: AAACTTGACGACTTTTAGTT CTCC This Paper N/A sgSF3B1 forward4: CACCGATAGCGGTTCAATGAC CACG This Paper N/A sgSF3B1 reverse4: AAACCGTGGTCATTGAACCGC TATC This Paper N/A sgSf3b1 forward3: CACCGAGACTGAAATTCTCG AATG This Paper N/A sgSf3b1 reverse3: AAACCATTCGAGAATTTCAG TCTC This Paper N/A sgSf3b1 forward4: CACCGATTACTATGCTAGAG TGGA This Paper N/A sgSf3b1 reverse4: AAACTCCACTCTAGCATAGT AATC This Paper N/A sgSf3b2 forward1: CACCGAAGTACCTTCAAGGC AAACG This Paper N/A sgSf3b2 reverse1: AAACCGTTTGCCTTGAAGGTA CTTC This Paper N/A sgSf3b2 forward2: CACCGTCGTCCTATAGGGAG TCGCG This Paper N/A sgSf3b2 reverse2: AAACCGCGACTCCCTATAGG ACGAC This Paper N/A sgSf3b3 forward1: CACCGAACACTCTGGTGTA TCACG This Paper N/A sgSf3b3 reverse1: AAACCGTGATACACCAGAG TGTTC This Paper N/A (Continued on next page) 18 Cell Reports 44, 116384, October 28, 2025

    Recombinant:

    Article Title: Spliceosome inhibition induces Z-RNA and ZBP1-driven cell death in small cell lung cancer.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, peptides, and recombinant proteins Pladienolide B Cayman Chemicals Cat# 445493-23-2; ID 16538 Matrigel Matrix Corning Cat# 354234 Bovine Serum Albumin (BSA) Fisher Scientific Cat# BP9703-100 RNaseA Thermo Fisher Scientific Cat# EN0531 RNaseH Thermo Fisher Scientific Cat# 18021014 DNaseI Set Zymo Research Cat# E1011-A Glycogen Thermo Fisher Scientific Cat# R0551 ITS Supplement Sigma Cat# 11884 B-Estradiol Sigma Cat# E2257 Hydrocortisone Sigma Cat# H4001 FBS Hyclone Cat# AAF204954 RPMI 1640 Medium Corning Cat# MT-50-020-PB Sodium Pyruvate Sigma Cat# P2256 HEPES Fisher Scientific Cat# BP310-500 Dextrose (D-) Glucose Fisher Scientific Cat# D15-500 Dulbecco’s Modification of Eagle’s Medium (DMEM) Corning Cat# MT50-013-PB Phosphate Buffered Saline 10X Corning Cat# 46-013-CM Penicillin Streptomycin Corning Cat# 30-002-CI L-Glutamine Corning Cat# 25-005-CI Paraformaldehyde, 4% in PBS Thermo Fisher Scientific Cat# J61899 Phosphate Buffered Saline Sigma Cat# D5652 Triton X-100 Sigma Cat# X100-500ML MAXblock Blocking Medium Active Motif Cat# 102224 ProLong Gold Antifade Mountant with DNA Stain DAPI Thermo Fisher Scientific Cat# P36935 Sucrose Thermo Fisher Scientific Cat# 036508.A1 Pierce RIPA Buffer Thermo Fisher Scientific Cat# 89900 Halt Protease Inhibitor Cocktail (100X) Thermo Fisher Scientific Cat# 78430 Halt Phosphatase Inhibitor Cocktail (100X) Thermo Fisher Scientific Cat# 78428 Chameleon Duo Pre-Stained Protein Ladder LICORbio Cat# 928-60000 Puromycin GIBCO Cat# A11138-03 Can Get Signal Immunoreaction Enhancer Solution 1 TOYOBO Cat# NKB-101 Can Get Signal Immunoreaction Enhancer Solution 2 TOYOBO Cat# NKB-201 Intercept Antibody Diluent LI-COR Cat# 927-65001 CoverGrip Coverslip Sealant Biotium Cat# 23005 Tween 20 Thermo Fisher Scientific Cat# J20605-AP IGEPAL Sigma Cat# 9002-93-1 1M MgCl 2 Invitrogen Cat# AM9530G 0.5M EDTA Solution (100X) Thermo Fisher Scientific Cat# 1860851 5M NaCl Thermo Fisher Scientific Cat# AM9759 Ambion DEPC-Treated Water Thermo Fisher Scientific Cat# AM9922 SuperScript III Reverse Transcriptase Thermo Fisher Scientifics Cat# 18080-044 RNaseOUT Ribonuclease Inhibitor Thermo Fisher Scientific Cat# 10777019 Power SYBR Green PCR Master Mix Applied Biosystems Cat# 4367659 (Continued on next page) Cell Reports 44, 116384, October 28, 2025 15 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligo (dT) 12–18 Primer Life Technologies Cat# 18418012 Random Primers Thermo Fisher Scientific Cat# 48190011 dNTP Mix, 10mM each Thermo Fisher Scientific Cat# R0191 TRIzol Reagent Thermo Fisher Scientific Cat# 15596018 2-Mercaptoethanol Bio-Rad Cat# 1610710 cOmplete Mini, EDTA-free Roche Cat# 11836170001 Collagenase P Roche Cat# 11213865001 Restore PLUS Western Blot Stripping Buffer Thermo Fisher Scientific Cat# 46430 InVivoPure pH 7.0 Dilution Buffer BioXCell Cat# IP0070 InVivoPlure pH 6.5 Dilution Buffer BioXCell Cat# IP0065 InVivoPlus rat IgG2a isotype control, Clone 2A3 BioXCell Cat# BP0089 InVivoPlus anti-mouse PD-1 (CD279), clone RMP1-14 BioXCell Cat# BP0146 SuperScript IV VILO Master Mix Thermo Fisher Scientific Cat# 11756050 RNasin Plus RNase Inhibitor Promega Cat# N2615 RNase ONE Ribonuclease Promega Cat #M4261 GSK843 Sigma Cat# SML2001-5MG Z-VAD-FMK Sellectchem Cat# S7023 Necrostatin-1 APExBio Cat# A4213 Cycloheximide Sigma Cat# C4859-1ML Recombinant Mouse TNF alpha (aa 80–235) Protein R&D Systems Cat# 410-MT Collagenase Sigma Cat# C5138-1G DnaseI from bovine pancreas grade II Roche Cat# 10104159001 MicroAmp Fast Optical 96-Well Reaction Plate with Barcode Applied Biosystems Cat# 4346906 Propidium Iodide Sigma Cat# P4170 10X TBS Bio-Rad Cat# 1706435 Mini Trans-Blot Filter Paper Bio-Rad Cat# 1703932 Phosphate Buffered Saline 10X Molecular Biology Grade Corning Cat# 46-013-CM RBC Lysis Buffer (10X) BioLegend Cat# 420302 Chloroform Fisher Scientific Cat# BP1145-1 Phenol:Chloroform:Isoamyl Alcohol 125:24:1 Sigma Cat# P1944-100ML Nitrocellulose Membrane, 0.45μM Bio-Rad Cat# 1620115 Nunc Lab-Tek II Chamber Slide System, 8 Wells Thermo Fisher Scientific Cat# 154941 Cover Slips Super Slip Epredia Cat# 12450S Polybrene (CAS 28728-55-4) Santa Cruz Cat# sc-134220A Sodium Bicarbonate Fisher Scientifics Cat# BP328-500 Actinomycin D Sigma Cat# A9415 Critical commercial assays Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat# 23225 CellTiter-Glo Luminescent Cell Viability Promega Cat# G7571 Bio-Rad Wet Tank Blotting System Bio-Rad Cat# 1658034 RNA Clean & Concentrator – 25 Zymo Research Cat# R1017 (Continued on next page) 16 Cell Reports 44, 116384, October 28, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Silencer Select Negative Control #1 siRNA Thermo Fisher Scientific Cat# 4390844 SF3B1 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4392420; ID: s223598 LRDD Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4392420; ID: s30843 PTEN Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4427037; ID: s61224 Pbrm1 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4390771; ID: s232536 RBM5 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4427037; ID: s19842 Herc4 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4390771; ID: s84900 Ddx31 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4390771; ID: s105733 Hdac6 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4390771; ID: s67426 Hhx32 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4390771; ID: s97751 STK38 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4427037; ID: s22337 sgSF3B1 forward3: CACCGGAGAACTAAAAGTCG TCAA This Paper N/A sgSF3B1 reverse3: AAACTTGACGACTTTTAGTT CTCC This Paper N/A sgSF3B1 forward4: CACCGATAGCGGTTCAATGAC CACG This Paper N/A sgSF3B1 reverse4: AAACCGTGGTCATTGAACCGC TATC This Paper N/A sgSf3b1 forward3: CACCGAGACTGAAATTCTCG AATG This Paper N/A sgSf3b1 reverse3: AAACCATTCGAGAATTTCAG TCTC This Paper N/A sgSf3b1 forward4: CACCGATTACTATGCTAGAG TGGA This Paper N/A sgSf3b1 reverse4: AAACTCCACTCTAGCATAGT AATC This Paper N/A sgSf3b2 forward1: CACCGAAGTACCTTCAAGGC AAACG This Paper N/A sgSf3b2 reverse1: AAACCGTTTGCCTTGAAGGTA CTTC This Paper N/A sgSf3b2 forward2: CACCGTCGTCCTATAGGGAG TCGCG This Paper N/A sgSf3b2 reverse2: AAACCGCGACTCCCTATAGG ACGAC This Paper N/A sgSf3b3 forward1: CACCGAACACTCTGGTGTA TCACG This Paper N/A sgSf3b3 reverse1: AAACCGTGATACACCAGAG TGTTC This Paper N/A (Continued on next page) 18 Cell Reports 44, 116384, October 28, 2025

    Saline:

    Article Title: Spliceosome inhibition induces Z-RNA and ZBP1-driven cell death in small cell lung cancer.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, peptides, and recombinant proteins Pladienolide B Cayman Chemicals Cat# 445493-23-2; ID 16538 Matrigel Matrix Corning Cat# 354234 Bovine Serum Albumin (BSA) Fisher Scientific Cat# BP9703-100 RNaseA Thermo Fisher Scientific Cat# EN0531 RNaseH Thermo Fisher Scientific Cat# 18021014 DNaseI Set Zymo Research Cat# E1011-A Glycogen Thermo Fisher Scientific Cat# R0551 ITS Supplement Sigma Cat# 11884 B-Estradiol Sigma Cat# E2257 Hydrocortisone Sigma Cat# H4001 FBS Hyclone Cat# AAF204954 RPMI 1640 Medium Corning Cat# MT-50-020-PB Sodium Pyruvate Sigma Cat# P2256 HEPES Fisher Scientific Cat# BP310-500 Dextrose (D-) Glucose Fisher Scientific Cat# D15-500 Dulbecco’s Modification of Eagle’s Medium (DMEM) Corning Cat# MT50-013-PB Phosphate Buffered Saline 10X Corning Cat# 46-013-CM Penicillin Streptomycin Corning Cat# 30-002-CI L-Glutamine Corning Cat# 25-005-CI Paraformaldehyde, 4% in PBS Thermo Fisher Scientific Cat# J61899 Phosphate Buffered Saline Sigma Cat# D5652 Triton X-100 Sigma Cat# X100-500ML MAXblock Blocking Medium Active Motif Cat# 102224 ProLong Gold Antifade Mountant with DNA Stain DAPI Thermo Fisher Scientific Cat# P36935 Sucrose Thermo Fisher Scientific Cat# 036508.A1 Pierce RIPA Buffer Thermo Fisher Scientific Cat# 89900 Halt Protease Inhibitor Cocktail (100X) Thermo Fisher Scientific Cat# 78430 Halt Phosphatase Inhibitor Cocktail (100X) Thermo Fisher Scientific Cat# 78428 Chameleon Duo Pre-Stained Protein Ladder LICORbio Cat# 928-60000 Puromycin GIBCO Cat# A11138-03 Can Get Signal Immunoreaction Enhancer Solution 1 TOYOBO Cat# NKB-101 Can Get Signal Immunoreaction Enhancer Solution 2 TOYOBO Cat# NKB-201 Intercept Antibody Diluent LI-COR Cat# 927-65001 CoverGrip Coverslip Sealant Biotium Cat# 23005 Tween 20 Thermo Fisher Scientific Cat# J20605-AP IGEPAL Sigma Cat# 9002-93-1 1M MgCl 2 Invitrogen Cat# AM9530G 0.5M EDTA Solution (100X) Thermo Fisher Scientific Cat# 1860851 5M NaCl Thermo Fisher Scientific Cat# AM9759 Ambion DEPC-Treated Water Thermo Fisher Scientific Cat# AM9922 SuperScript III Reverse Transcriptase Thermo Fisher Scientifics Cat# 18080-044 RNaseOUT Ribonuclease Inhibitor Thermo Fisher Scientific Cat# 10777019 Power SYBR Green PCR Master Mix Applied Biosystems Cat# 4367659 (Continued on next page) Cell Reports 44, 116384, October 28, 2025 15 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligo (dT) 12–18 Primer Life Technologies Cat# 18418012 Random Primers Thermo Fisher Scientific Cat# 48190011 dNTP Mix, 10mM each Thermo Fisher Scientific Cat# R0191 TRIzol Reagent Thermo Fisher Scientific Cat# 15596018 2-Mercaptoethanol Bio-Rad Cat# 1610710 cOmplete Mini, EDTA-free Roche Cat# 11836170001 Collagenase P Roche Cat# 11213865001 Restore PLUS Western Blot Stripping Buffer Thermo Fisher Scientific Cat# 46430 InVivoPure pH 7.0 Dilution Buffer BioXCell Cat# IP0070 InVivoPlure pH 6.5 Dilution Buffer BioXCell Cat# IP0065 InVivoPlus rat IgG2a isotype control, Clone 2A3 BioXCell Cat# BP0089 InVivoPlus anti-mouse PD-1 (CD279), clone RMP1-14 BioXCell Cat# BP0146 SuperScript IV VILO Master Mix Thermo Fisher Scientific Cat# 11756050 RNasin Plus RNase Inhibitor Promega Cat# N2615 RNase ONE Ribonuclease Promega Cat #M4261 GSK843 Sigma Cat# SML2001-5MG Z-VAD-FMK Sellectchem Cat# S7023 Necrostatin-1 APExBio Cat# A4213 Cycloheximide Sigma Cat# C4859-1ML Recombinant Mouse TNF alpha (aa 80–235) Protein R&D Systems Cat# 410-MT Collagenase Sigma Cat# C5138-1G DnaseI from bovine pancreas grade II Roche Cat# 10104159001 MicroAmp Fast Optical 96-Well Reaction Plate with Barcode Applied Biosystems Cat# 4346906 Propidium Iodide Sigma Cat# P4170 10X TBS Bio-Rad Cat# 1706435 Mini Trans-Blot Filter Paper Bio-Rad Cat# 1703932 Phosphate Buffered Saline 10X Molecular Biology Grade Corning Cat# 46-013-CM RBC Lysis Buffer (10X) BioLegend Cat# 420302 Chloroform Fisher Scientific Cat# BP1145-1 Phenol:Chloroform:Isoamyl Alcohol 125:24:1 Sigma Cat# P1944-100ML Nitrocellulose Membrane, 0.45μM Bio-Rad Cat# 1620115 Nunc Lab-Tek II Chamber Slide System, 8 Wells Thermo Fisher Scientific Cat# 154941 Cover Slips Super Slip Epredia Cat# 12450S Polybrene (CAS 28728-55-4) Santa Cruz Cat# sc-134220A Sodium Bicarbonate Fisher Scientifics Cat# BP328-500 Actinomycin D Sigma Cat# A9415 Critical commercial assays Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat# 23225 CellTiter-Glo Luminescent Cell Viability Promega Cat# G7571 Bio-Rad Wet Tank Blotting System Bio-Rad Cat# 1658034 RNA Clean & Concentrator – 25 Zymo Research Cat# R1017 (Continued on next page) 16 Cell Reports 44, 116384, October 28, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Silencer Select Negative Control #1 siRNA Thermo Fisher Scientific Cat# 4390844 SF3B1 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4392420; ID: s223598 LRDD Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4392420; ID: s30843 PTEN Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4427037; ID: s61224 Pbrm1 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4390771; ID: s232536 RBM5 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4427037; ID: s19842 Herc4 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4390771; ID: s84900 Ddx31 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4390771; ID: s105733 Hdac6 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4390771; ID: s67426 Hhx32 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4390771; ID: s97751 STK38 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4427037; ID: s22337 sgSF3B1 forward3: CACCGGAGAACTAAAAGTCG TCAA This Paper N/A sgSF3B1 reverse3: AAACTTGACGACTTTTAGTT CTCC This Paper N/A sgSF3B1 forward4: CACCGATAGCGGTTCAATGAC CACG This Paper N/A sgSF3B1 reverse4: AAACCGTGGTCATTGAACCGC TATC This Paper N/A sgSf3b1 forward3: CACCGAGACTGAAATTCTCG AATG This Paper N/A sgSf3b1 reverse3: AAACCATTCGAGAATTTCAG TCTC This Paper N/A sgSf3b1 forward4: CACCGATTACTATGCTAGAG TGGA This Paper N/A sgSf3b1 reverse4: AAACTCCACTCTAGCATAGT AATC This Paper N/A sgSf3b2 forward1: CACCGAAGTACCTTCAAGGC AAACG This Paper N/A sgSf3b2 reverse1: AAACCGTTTGCCTTGAAGGTA CTTC This Paper N/A sgSf3b2 forward2: CACCGTCGTCCTATAGGGAG TCGCG This Paper N/A sgSf3b2 reverse2: AAACCGCGACTCCCTATAGG ACGAC This Paper N/A sgSf3b3 forward1: CACCGAACACTCTGGTGTA TCACG This Paper N/A sgSf3b3 reverse1: AAACCGTGATACACCAGAG TGTTC This Paper N/A (Continued on next page) 18 Cell Reports 44, 116384, October 28, 2025

    Red Blood Cell Lysis:

    Article Title: Spliceosome inhibition induces Z-RNA and ZBP1-driven cell death in small cell lung cancer.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, peptides, and recombinant proteins Pladienolide B Cayman Chemicals Cat# 445493-23-2; ID 16538 Matrigel Matrix Corning Cat# 354234 Bovine Serum Albumin (BSA) Fisher Scientific Cat# BP9703-100 RNaseA Thermo Fisher Scientific Cat# EN0531 RNaseH Thermo Fisher Scientific Cat# 18021014 DNaseI Set Zymo Research Cat# E1011-A Glycogen Thermo Fisher Scientific Cat# R0551 ITS Supplement Sigma Cat# 11884 B-Estradiol Sigma Cat# E2257 Hydrocortisone Sigma Cat# H4001 FBS Hyclone Cat# AAF204954 RPMI 1640 Medium Corning Cat# MT-50-020-PB Sodium Pyruvate Sigma Cat# P2256 HEPES Fisher Scientific Cat# BP310-500 Dextrose (D-) Glucose Fisher Scientific Cat# D15-500 Dulbecco’s Modification of Eagle’s Medium (DMEM) Corning Cat# MT50-013-PB Phosphate Buffered Saline 10X Corning Cat# 46-013-CM Penicillin Streptomycin Corning Cat# 30-002-CI L-Glutamine Corning Cat# 25-005-CI Paraformaldehyde, 4% in PBS Thermo Fisher Scientific Cat# J61899 Phosphate Buffered Saline Sigma Cat# D5652 Triton X-100 Sigma Cat# X100-500ML MAXblock Blocking Medium Active Motif Cat# 102224 ProLong Gold Antifade Mountant with DNA Stain DAPI Thermo Fisher Scientific Cat# P36935 Sucrose Thermo Fisher Scientific Cat# 036508.A1 Pierce RIPA Buffer Thermo Fisher Scientific Cat# 89900 Halt Protease Inhibitor Cocktail (100X) Thermo Fisher Scientific Cat# 78430 Halt Phosphatase Inhibitor Cocktail (100X) Thermo Fisher Scientific Cat# 78428 Chameleon Duo Pre-Stained Protein Ladder LICORbio Cat# 928-60000 Puromycin GIBCO Cat# A11138-03 Can Get Signal Immunoreaction Enhancer Solution 1 TOYOBO Cat# NKB-101 Can Get Signal Immunoreaction Enhancer Solution 2 TOYOBO Cat# NKB-201 Intercept Antibody Diluent LI-COR Cat# 927-65001 CoverGrip Coverslip Sealant Biotium Cat# 23005 Tween 20 Thermo Fisher Scientific Cat# J20605-AP IGEPAL Sigma Cat# 9002-93-1 1M MgCl 2 Invitrogen Cat# AM9530G 0.5M EDTA Solution (100X) Thermo Fisher Scientific Cat# 1860851 5M NaCl Thermo Fisher Scientific Cat# AM9759 Ambion DEPC-Treated Water Thermo Fisher Scientific Cat# AM9922 SuperScript III Reverse Transcriptase Thermo Fisher Scientifics Cat# 18080-044 RNaseOUT Ribonuclease Inhibitor Thermo Fisher Scientific Cat# 10777019 Power SYBR Green PCR Master Mix Applied Biosystems Cat# 4367659 (Continued on next page) Cell Reports 44, 116384, October 28, 2025 15 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligo (dT) 12–18 Primer Life Technologies Cat# 18418012 Random Primers Thermo Fisher Scientific Cat# 48190011 dNTP Mix, 10mM each Thermo Fisher Scientific Cat# R0191 TRIzol Reagent Thermo Fisher Scientific Cat# 15596018 2-Mercaptoethanol Bio-Rad Cat# 1610710 cOmplete Mini, EDTA-free Roche Cat# 11836170001 Collagenase P Roche Cat# 11213865001 Restore PLUS Western Blot Stripping Buffer Thermo Fisher Scientific Cat# 46430 InVivoPure pH 7.0 Dilution Buffer BioXCell Cat# IP0070 InVivoPlure pH 6.5 Dilution Buffer BioXCell Cat# IP0065 InVivoPlus rat IgG2a isotype control, Clone 2A3 BioXCell Cat# BP0089 InVivoPlus anti-mouse PD-1 (CD279), clone RMP1-14 BioXCell Cat# BP0146 SuperScript IV VILO Master Mix Thermo Fisher Scientific Cat# 11756050 RNasin Plus RNase Inhibitor Promega Cat# N2615 RNase ONE Ribonuclease Promega Cat #M4261 GSK843 Sigma Cat# SML2001-5MG Z-VAD-FMK Sellectchem Cat# S7023 Necrostatin-1 APExBio Cat# A4213 Cycloheximide Sigma Cat# C4859-1ML Recombinant Mouse TNF alpha (aa 80–235) Protein R&D Systems Cat# 410-MT Collagenase Sigma Cat# C5138-1G DnaseI from bovine pancreas grade II Roche Cat# 10104159001 MicroAmp Fast Optical 96-Well Reaction Plate with Barcode Applied Biosystems Cat# 4346906 Propidium Iodide Sigma Cat# P4170 10X TBS Bio-Rad Cat# 1706435 Mini Trans-Blot Filter Paper Bio-Rad Cat# 1703932 Phosphate Buffered Saline 10X Molecular Biology Grade Corning Cat# 46-013-CM RBC Lysis Buffer (10X) BioLegend Cat# 420302 Chloroform Fisher Scientific Cat# BP1145-1 Phenol:Chloroform:Isoamyl Alcohol 125:24:1 Sigma Cat# P1944-100ML Nitrocellulose Membrane, 0.45μM Bio-Rad Cat# 1620115 Nunc Lab-Tek II Chamber Slide System, 8 Wells Thermo Fisher Scientific Cat# 154941 Cover Slips Super Slip Epredia Cat# 12450S Polybrene (CAS 28728-55-4) Santa Cruz Cat# sc-134220A Sodium Bicarbonate Fisher Scientifics Cat# BP328-500 Actinomycin D Sigma Cat# A9415 Critical commercial assays Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat# 23225 CellTiter-Glo Luminescent Cell Viability Promega Cat# G7571 Bio-Rad Wet Tank Blotting System Bio-Rad Cat# 1658034 RNA Clean & Concentrator – 25 Zymo Research Cat# R1017 (Continued on next page) 16 Cell Reports 44, 116384, October 28, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Silencer Select Negative Control #1 siRNA Thermo Fisher Scientific Cat# 4390844 SF3B1 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4392420; ID: s223598 LRDD Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4392420; ID: s30843 PTEN Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4427037; ID: s61224 Pbrm1 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4390771; ID: s232536 RBM5 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4427037; ID: s19842 Herc4 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4390771; ID: s84900 Ddx31 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4390771; ID: s105733 Hdac6 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4390771; ID: s67426 Hhx32 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4390771; ID: s97751 STK38 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4427037; ID: s22337 sgSF3B1 forward3: CACCGGAGAACTAAAAGTCG TCAA This Paper N/A sgSF3B1 reverse3: AAACTTGACGACTTTTAGTT CTCC This Paper N/A sgSF3B1 forward4: CACCGATAGCGGTTCAATGAC CACG This Paper N/A sgSF3B1 reverse4: AAACCGTGGTCATTGAACCGC TATC This Paper N/A sgSf3b1 forward3: CACCGAGACTGAAATTCTCG AATG This Paper N/A sgSf3b1 reverse3: AAACCATTCGAGAATTTCAG TCTC This Paper N/A sgSf3b1 forward4: CACCGATTACTATGCTAGAG TGGA This Paper N/A sgSf3b1 reverse4: AAACTCCACTCTAGCATAGT AATC This Paper N/A sgSf3b2 forward1: CACCGAAGTACCTTCAAGGC AAACG This Paper N/A sgSf3b2 reverse1: AAACCGTTTGCCTTGAAGGTA CTTC This Paper N/A sgSf3b2 forward2: CACCGTCGTCCTATAGGGAG TCGCG This Paper N/A sgSf3b2 reverse2: AAACCGCGACTCCCTATAGG ACGAC This Paper N/A sgSf3b3 forward1: CACCGAACACTCTGGTGTA TCACG This Paper N/A sgSf3b3 reverse1: AAACCGTGATACACCAGAG TGTTC This Paper N/A (Continued on next page) 18 Cell Reports 44, 116384, October 28, 2025

    Membrane:

    Article Title: Spliceosome inhibition induces Z-RNA and ZBP1-driven cell death in small cell lung cancer.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, peptides, and recombinant proteins Pladienolide B Cayman Chemicals Cat# 445493-23-2; ID 16538 Matrigel Matrix Corning Cat# 354234 Bovine Serum Albumin (BSA) Fisher Scientific Cat# BP9703-100 RNaseA Thermo Fisher Scientific Cat# EN0531 RNaseH Thermo Fisher Scientific Cat# 18021014 DNaseI Set Zymo Research Cat# E1011-A Glycogen Thermo Fisher Scientific Cat# R0551 ITS Supplement Sigma Cat# 11884 B-Estradiol Sigma Cat# E2257 Hydrocortisone Sigma Cat# H4001 FBS Hyclone Cat# AAF204954 RPMI 1640 Medium Corning Cat# MT-50-020-PB Sodium Pyruvate Sigma Cat# P2256 HEPES Fisher Scientific Cat# BP310-500 Dextrose (D-) Glucose Fisher Scientific Cat# D15-500 Dulbecco’s Modification of Eagle’s Medium (DMEM) Corning Cat# MT50-013-PB Phosphate Buffered Saline 10X Corning Cat# 46-013-CM Penicillin Streptomycin Corning Cat# 30-002-CI L-Glutamine Corning Cat# 25-005-CI Paraformaldehyde, 4% in PBS Thermo Fisher Scientific Cat# J61899 Phosphate Buffered Saline Sigma Cat# D5652 Triton X-100 Sigma Cat# X100-500ML MAXblock Blocking Medium Active Motif Cat# 102224 ProLong Gold Antifade Mountant with DNA Stain DAPI Thermo Fisher Scientific Cat# P36935 Sucrose Thermo Fisher Scientific Cat# 036508.A1 Pierce RIPA Buffer Thermo Fisher Scientific Cat# 89900 Halt Protease Inhibitor Cocktail (100X) Thermo Fisher Scientific Cat# 78430 Halt Phosphatase Inhibitor Cocktail (100X) Thermo Fisher Scientific Cat# 78428 Chameleon Duo Pre-Stained Protein Ladder LICORbio Cat# 928-60000 Puromycin GIBCO Cat# A11138-03 Can Get Signal Immunoreaction Enhancer Solution 1 TOYOBO Cat# NKB-101 Can Get Signal Immunoreaction Enhancer Solution 2 TOYOBO Cat# NKB-201 Intercept Antibody Diluent LI-COR Cat# 927-65001 CoverGrip Coverslip Sealant Biotium Cat# 23005 Tween 20 Thermo Fisher Scientific Cat# J20605-AP IGEPAL Sigma Cat# 9002-93-1 1M MgCl 2 Invitrogen Cat# AM9530G 0.5M EDTA Solution (100X) Thermo Fisher Scientific Cat# 1860851 5M NaCl Thermo Fisher Scientific Cat# AM9759 Ambion DEPC-Treated Water Thermo Fisher Scientific Cat# AM9922 SuperScript III Reverse Transcriptase Thermo Fisher Scientifics Cat# 18080-044 RNaseOUT Ribonuclease Inhibitor Thermo Fisher Scientific Cat# 10777019 Power SYBR Green PCR Master Mix Applied Biosystems Cat# 4367659 (Continued on next page) Cell Reports 44, 116384, October 28, 2025 15 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligo (dT) 12–18 Primer Life Technologies Cat# 18418012 Random Primers Thermo Fisher Scientific Cat# 48190011 dNTP Mix, 10mM each Thermo Fisher Scientific Cat# R0191 TRIzol Reagent Thermo Fisher Scientific Cat# 15596018 2-Mercaptoethanol Bio-Rad Cat# 1610710 cOmplete Mini, EDTA-free Roche Cat# 11836170001 Collagenase P Roche Cat# 11213865001 Restore PLUS Western Blot Stripping Buffer Thermo Fisher Scientific Cat# 46430 InVivoPure pH 7.0 Dilution Buffer BioXCell Cat# IP0070 InVivoPlure pH 6.5 Dilution Buffer BioXCell Cat# IP0065 InVivoPlus rat IgG2a isotype control, Clone 2A3 BioXCell Cat# BP0089 InVivoPlus anti-mouse PD-1 (CD279), clone RMP1-14 BioXCell Cat# BP0146 SuperScript IV VILO Master Mix Thermo Fisher Scientific Cat# 11756050 RNasin Plus RNase Inhibitor Promega Cat# N2615 RNase ONE Ribonuclease Promega Cat #M4261 GSK843 Sigma Cat# SML2001-5MG Z-VAD-FMK Sellectchem Cat# S7023 Necrostatin-1 APExBio Cat# A4213 Cycloheximide Sigma Cat# C4859-1ML Recombinant Mouse TNF alpha (aa 80–235) Protein R&D Systems Cat# 410-MT Collagenase Sigma Cat# C5138-1G DnaseI from bovine pancreas grade II Roche Cat# 10104159001 MicroAmp Fast Optical 96-Well Reaction Plate with Barcode Applied Biosystems Cat# 4346906 Propidium Iodide Sigma Cat# P4170 10X TBS Bio-Rad Cat# 1706435 Mini Trans-Blot Filter Paper Bio-Rad Cat# 1703932 Phosphate Buffered Saline 10X Molecular Biology Grade Corning Cat# 46-013-CM RBC Lysis Buffer (10X) BioLegend Cat# 420302 Chloroform Fisher Scientific Cat# BP1145-1 Phenol:Chloroform:Isoamyl Alcohol 125:24:1 Sigma Cat# P1944-100ML Nitrocellulose Membrane, 0.45μM Bio-Rad Cat# 1620115 Nunc Lab-Tek II Chamber Slide System, 8 Wells Thermo Fisher Scientific Cat# 154941 Cover Slips Super Slip Epredia Cat# 12450S Polybrene (CAS 28728-55-4) Santa Cruz Cat# sc-134220A Sodium Bicarbonate Fisher Scientifics Cat# BP328-500 Actinomycin D Sigma Cat# A9415 Critical commercial assays Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat# 23225 CellTiter-Glo Luminescent Cell Viability Promega Cat# G7571 Bio-Rad Wet Tank Blotting System Bio-Rad Cat# 1658034 RNA Clean & Concentrator – 25 Zymo Research Cat# R1017 (Continued on next page) 16 Cell Reports 44, 116384, October 28, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Silencer Select Negative Control #1 siRNA Thermo Fisher Scientific Cat# 4390844 SF3B1 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4392420; ID: s223598 LRDD Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4392420; ID: s30843 PTEN Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4427037; ID: s61224 Pbrm1 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4390771; ID: s232536 RBM5 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4427037; ID: s19842 Herc4 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4390771; ID: s84900 Ddx31 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4390771; ID: s105733 Hdac6 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4390771; ID: s67426 Hhx32 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4390771; ID: s97751 STK38 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4427037; ID: s22337 sgSF3B1 forward3: CACCGGAGAACTAAAAGTCG TCAA This Paper N/A sgSF3B1 reverse3: AAACTTGACGACTTTTAGTT CTCC This Paper N/A sgSF3B1 forward4: CACCGATAGCGGTTCAATGAC CACG This Paper N/A sgSF3B1 reverse4: AAACCGTGGTCATTGAACCGC TATC This Paper N/A sgSf3b1 forward3: CACCGAGACTGAAATTCTCG AATG This Paper N/A sgSf3b1 reverse3: AAACCATTCGAGAATTTCAG TCTC This Paper N/A sgSf3b1 forward4: CACCGATTACTATGCTAGAG TGGA This Paper N/A sgSf3b1 reverse4: AAACTCCACTCTAGCATAGT AATC This Paper N/A sgSf3b2 forward1: CACCGAAGTACCTTCAAGGC AAACG This Paper N/A sgSf3b2 reverse1: AAACCGTTTGCCTTGAAGGTA CTTC This Paper N/A sgSf3b2 forward2: CACCGTCGTCCTATAGGGAG TCGCG This Paper N/A sgSf3b2 reverse2: AAACCGCGACTCCCTATAGG ACGAC This Paper N/A sgSf3b3 forward1: CACCGAACACTCTGGTGTA TCACG This Paper N/A sgSf3b3 reverse1: AAACCGTGATACACCAGAG TGTTC This Paper N/A (Continued on next page) 18 Cell Reports 44, 116384, October 28, 2025

    Bicinchoninic Acid Protein Assay:

    Article Title: Spliceosome inhibition induces Z-RNA and ZBP1-driven cell death in small cell lung cancer.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, peptides, and recombinant proteins Pladienolide B Cayman Chemicals Cat# 445493-23-2; ID 16538 Matrigel Matrix Corning Cat# 354234 Bovine Serum Albumin (BSA) Fisher Scientific Cat# BP9703-100 RNaseA Thermo Fisher Scientific Cat# EN0531 RNaseH Thermo Fisher Scientific Cat# 18021014 DNaseI Set Zymo Research Cat# E1011-A Glycogen Thermo Fisher Scientific Cat# R0551 ITS Supplement Sigma Cat# 11884 B-Estradiol Sigma Cat# E2257 Hydrocortisone Sigma Cat# H4001 FBS Hyclone Cat# AAF204954 RPMI 1640 Medium Corning Cat# MT-50-020-PB Sodium Pyruvate Sigma Cat# P2256 HEPES Fisher Scientific Cat# BP310-500 Dextrose (D-) Glucose Fisher Scientific Cat# D15-500 Dulbecco’s Modification of Eagle’s Medium (DMEM) Corning Cat# MT50-013-PB Phosphate Buffered Saline 10X Corning Cat# 46-013-CM Penicillin Streptomycin Corning Cat# 30-002-CI L-Glutamine Corning Cat# 25-005-CI Paraformaldehyde, 4% in PBS Thermo Fisher Scientific Cat# J61899 Phosphate Buffered Saline Sigma Cat# D5652 Triton X-100 Sigma Cat# X100-500ML MAXblock Blocking Medium Active Motif Cat# 102224 ProLong Gold Antifade Mountant with DNA Stain DAPI Thermo Fisher Scientific Cat# P36935 Sucrose Thermo Fisher Scientific Cat# 036508.A1 Pierce RIPA Buffer Thermo Fisher Scientific Cat# 89900 Halt Protease Inhibitor Cocktail (100X) Thermo Fisher Scientific Cat# 78430 Halt Phosphatase Inhibitor Cocktail (100X) Thermo Fisher Scientific Cat# 78428 Chameleon Duo Pre-Stained Protein Ladder LICORbio Cat# 928-60000 Puromycin GIBCO Cat# A11138-03 Can Get Signal Immunoreaction Enhancer Solution 1 TOYOBO Cat# NKB-101 Can Get Signal Immunoreaction Enhancer Solution 2 TOYOBO Cat# NKB-201 Intercept Antibody Diluent LI-COR Cat# 927-65001 CoverGrip Coverslip Sealant Biotium Cat# 23005 Tween 20 Thermo Fisher Scientific Cat# J20605-AP IGEPAL Sigma Cat# 9002-93-1 1M MgCl 2 Invitrogen Cat# AM9530G 0.5M EDTA Solution (100X) Thermo Fisher Scientific Cat# 1860851 5M NaCl Thermo Fisher Scientific Cat# AM9759 Ambion DEPC-Treated Water Thermo Fisher Scientific Cat# AM9922 SuperScript III Reverse Transcriptase Thermo Fisher Scientifics Cat# 18080-044 RNaseOUT Ribonuclease Inhibitor Thermo Fisher Scientific Cat# 10777019 Power SYBR Green PCR Master Mix Applied Biosystems Cat# 4367659 (Continued on next page) Cell Reports 44, 116384, October 28, 2025 15 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligo (dT) 12–18 Primer Life Technologies Cat# 18418012 Random Primers Thermo Fisher Scientific Cat# 48190011 dNTP Mix, 10mM each Thermo Fisher Scientific Cat# R0191 TRIzol Reagent Thermo Fisher Scientific Cat# 15596018 2-Mercaptoethanol Bio-Rad Cat# 1610710 cOmplete Mini, EDTA-free Roche Cat# 11836170001 Collagenase P Roche Cat# 11213865001 Restore PLUS Western Blot Stripping Buffer Thermo Fisher Scientific Cat# 46430 InVivoPure pH 7.0 Dilution Buffer BioXCell Cat# IP0070 InVivoPlure pH 6.5 Dilution Buffer BioXCell Cat# IP0065 InVivoPlus rat IgG2a isotype control, Clone 2A3 BioXCell Cat# BP0089 InVivoPlus anti-mouse PD-1 (CD279), clone RMP1-14 BioXCell Cat# BP0146 SuperScript IV VILO Master Mix Thermo Fisher Scientific Cat# 11756050 RNasin Plus RNase Inhibitor Promega Cat# N2615 RNase ONE Ribonuclease Promega Cat #M4261 GSK843 Sigma Cat# SML2001-5MG Z-VAD-FMK Sellectchem Cat# S7023 Necrostatin-1 APExBio Cat# A4213 Cycloheximide Sigma Cat# C4859-1ML Recombinant Mouse TNF alpha (aa 80–235) Protein R&D Systems Cat# 410-MT Collagenase Sigma Cat# C5138-1G DnaseI from bovine pancreas grade II Roche Cat# 10104159001 MicroAmp Fast Optical 96-Well Reaction Plate with Barcode Applied Biosystems Cat# 4346906 Propidium Iodide Sigma Cat# P4170 10X TBS Bio-Rad Cat# 1706435 Mini Trans-Blot Filter Paper Bio-Rad Cat# 1703932 Phosphate Buffered Saline 10X Molecular Biology Grade Corning Cat# 46-013-CM RBC Lysis Buffer (10X) BioLegend Cat# 420302 Chloroform Fisher Scientific Cat# BP1145-1 Phenol:Chloroform:Isoamyl Alcohol 125:24:1 Sigma Cat# P1944-100ML Nitrocellulose Membrane, 0.45μM Bio-Rad Cat# 1620115 Nunc Lab-Tek II Chamber Slide System, 8 Wells Thermo Fisher Scientific Cat# 154941 Cover Slips Super Slip Epredia Cat# 12450S Polybrene (CAS 28728-55-4) Santa Cruz Cat# sc-134220A Sodium Bicarbonate Fisher Scientifics Cat# BP328-500 Actinomycin D Sigma Cat# A9415 Critical commercial assays Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat# 23225 CellTiter-Glo Luminescent Cell Viability Promega Cat# G7571 Bio-Rad Wet Tank Blotting System Bio-Rad Cat# 1658034 RNA Clean & Concentrator – 25 Zymo Research Cat# R1017 (Continued on next page) 16 Cell Reports 44, 116384, October 28, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Silencer Select Negative Control #1 siRNA Thermo Fisher Scientific Cat# 4390844 SF3B1 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4392420; ID: s223598 LRDD Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4392420; ID: s30843 PTEN Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4427037; ID: s61224 Pbrm1 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4390771; ID: s232536 RBM5 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4427037; ID: s19842 Herc4 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4390771; ID: s84900 Ddx31 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4390771; ID: s105733 Hdac6 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4390771; ID: s67426 Hhx32 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4390771; ID: s97751 STK38 Silencer Select Pre-designed siRNA Thermo Fisher Scientific Cat# 4427037; ID: s22337 sgSF3B1 forward3: CACCGGAGAACTAAAAGTCG TCAA This Paper N/A sgSF3B1 reverse3: AAACTTGACGACTTTTAGTT CTCC This Paper N/A sgSF3B1 forward4: CACCGATAGCGGTTCAATGAC CACG This Paper N/A sgSF3B1 reverse4: AAACCGTGGTCATTGAACCGC TATC This Paper N/A sgSf3b1 forward3: CACCGAGACTGAAATTCTCG AATG This Paper N/A sgSf3b1 reverse3: AAACCATTCGAGAATTTCAG TCTC This Paper N/A sgSf3b1 forward4: CACCGATTACTATGCTAGAG TGGA This Paper N/A sgSf3b1 reverse4: AAACTCCACTCTAGCATAGT AATC This Paper N/A sgSf3b2 forward1: CACCGAAGTACCTTCAAGGC AAACG This Paper N/A sgSf3b2 reverse1: AAACCGTTTGCCTTGAAGGTA CTTC This Paper N/A sgSf3b2 forward2: CACCGTCGTCCTATAGGGAG TCGCG This Paper N/A sgSf3b2 reverse2: AAACCGCGACTCCCTATAGG ACGAC This Paper N/A sgSf3b3 forward1: CACCGAACACTCTGGTGTA TCACG This Paper N/A sgSf3b3 reverse1: AAACCGTGATACACCAGAG TGTTC This Paper N/A (Continued on next page) 18 Cell Reports 44, 116384, October 28, 2025



    Similar Products

    bp0089 invivoplus anti mouse pd 1  (Bio X Cell)
    96
    Bio X Cell bp0089 invivoplus anti mouse pd 1
    Bp0089 Invivoplus Anti Mouse Pd 1, supplied by Bio X Cell, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bp0089+invivoplus+anti+mouse+pd+1/InVivoPlus+rat+IgG2a+isotype+control%2C+anti-trinitrophenol/pm41046514-647-87-94
    Average 96 stars, based on 1 article reviews
    bp0089 invivoplus anti mouse pd 1 - by Bioz Stars, 2026-11
    96/100 stars
    		  Buy from Supplier
    invivoplus anti mouse pd 1 cd279  (Bio X Cell)
    96
    Bio X Cell invivoplus anti mouse pd 1 cd279

    Invivoplus Anti Mouse Pd 1 Cd279, supplied by Bio X Cell, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bp0089+invivoplus+anti+mouse+pd+1/InVivoPlus+rat+IgG2a+isotype+control%2C+anti-trinitrophenol/pmc11872463-392-6-13
    Average 96 stars, based on 1 article reviews
    invivoplus anti mouse pd 1 cd279 - by Bioz Stars, 2026-11
    96/100 stars
    		  Buy from Supplier

    Image Search Results


    Journal: iScience

    Article Title: Identification of a group of 9-amino-acridines that selectively downregulate regulatory T cell functions through FoxP3

    doi: 10.1016/j.isci.2025.111931

    Figure Lengend Snippet:

    Article Snippet: InVivoPlus rat IgG2a isotype control and InVivoPlus anti-mouse PD-1 (CD279) were purchased from BioXcell.

    Techniques: Control, Binding Assay, Staining, Virus, Recombinant, Avidin-Biotin Assay, Cell Isolation, Activation Assay, Amplified Luminescent Proximity Homogenous Assay, cDNA Synthesis, ChIP-qPCR, Software